britneyquezada1300 britneyquezada1300

01-12-2018
Geography

contestada

The marginal cost of making a computer is $ 75. At a computer price of $100, a producer _. A. Earns profits B. Just covers costs C. Loses money

Respuesta :

ChillMuse ChillMuse

02-12-2018

The correct answer is A. Earns profits. This is because, while the cost is $75, the selling price is $100, so the profit is $100 - $75 = $25.

Answer Link

Otras preguntas

what causes a warm air mass to move over a cold air mass instead of mixing with it

Write the linear equation in Slope Intercept form for a slope of -2 and a y- intercept of 6

Find the value of x in the equation below. 20= x+12

Of the following, which is NOT a way to classify a biome? A. Temperature B. Number of jobs available C. Rainfall D. Communities

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

was the feels by twice really worth it ?

En un quiosco hay 40 cajas de cromos. Cada caja contiene 25 paquetes. Cada paquete lleva 7 cromos. El quiosquero vende 12 paquetes. ¿Cuantos cromos quedan en el

IM GIVINIG BRAIN TO CORRECT ANSWERWhich two Enlightenment philosophers are known for writing about a social contract between citizens and the government?Montesq

One small airplane has 44 seats. The flight crew sits in two of these seats. The remaining seats are divided equally into 7 rows for passengers. Explain how you

During the Industrial Age, what caused a growth in labor union membership in the United States? A . the effectiveness of the Sherman Antitrust Act B. the federa