summerjordan44 summerjordan44

02-06-2022
Mathematics

contestada

Which number is rational?
Ο Α. π
Ο Β. εξ
Ο c. 0.777...
Ο D. 0.36458121...

Respuesta :

Mohamed1429 Mohamed1429

02-06-2022

Step-by-step explanation:

0.777... is rational since it can be put in fraction form which is 7/9

note: if something can be put as an integer/integer its rational

Answer Link

Otras preguntas

In what ways can the government intervene in the economy for the benefit of the country’s citizens?

brian made a tasty burger . the diameter of the buger was 5cm what is the radius of the circle

( URGENT PLEASE HELP)!! Jack and his sister Jill have planned their training for running a 5K race. Since Jack is taller than Jill, Jill must take 5 strides for

False 3. In 1890, most farmers in Kansas were tenant farmers. *

whats the ninth term of 25 20 15 10 5

What is the moment that the wrench puts on the bolt? -40 lb-ft -60 lb-ft -160 lb-ft -120 lb-ft

Freight Terms Determine the amount to be paid in full settlement of each of two invoices, (a) and (b), assuming that credit for returns and allowances was recei

Helppppppp meeeeeee plssssss I need right answer!

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Calculate the speed of a marble that rolls 9 cm in 4 seconds