lababy13 lababy13

02-01-2019
Biology

contestada

What type of relationship do fungi have with plants?

A. commensalism
B. Mutualism

Respuesta :

bankscherish20p8obv9 bankscherish20p8obv9

02-01-2019

Mutalism because they both benefit each other

Answer Link

rose6449 rose6449

02-01-2019

The type of relationships fungi have with plants is mutualism

Answer Link

Otras preguntas

what is the theoretical probability of picking a diamond from a standard deck of car

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h

The chloroplast found within a photosynthetic protist is surrounded by four membranes. how can we account for this

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Fractures of the blank of long bones are especially common in young animals

According to Christian teaching, Jesus taught in ________________or short stories that used analogies to tell religious truth. Stories Analogies Metaphors Parab

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?

What is the elapsed time

hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C

A mixture from which some of the particles settle out slowly upon standing