notgoodatmath9376 notgoodatmath9376
  • 11-04-2019
  • Computers and Technology
contestada

Raul in Colombia can enter data into a spreadsheet. Olivia in England can access the spreadsheet a few minutes later and use Raul's data in her report. True False

Respuesta :

traveller135 traveller135
  • 13-04-2019

True, as long as the application is a cloud-based spreadsheet (like Google Docs or MS Office 365), which allows multiple users in any location to view or edit the data with proper access permissions.

Answer Link

Otras preguntas

Triangle abc has vertices a(0 0) b(6 8) and c(8 4). which equation represents the perpendicular bisector of bc
What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.
If you’re over 21 you could be arrested for a DUI if your PAC is at or over ? Thanks
Need help asappp plzz helppp
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession
In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?