mmaeh1408 mmaeh1408

03-04-2020
Mathematics

contestada

HURRY TIME LIMIT
Which is the equation of a line that has a slope of 1 and passes through point (5, 3)?

Respuesta :

fussellk fussellk

03-04-2020

Answer:

y = x-2

Step-by-step explanation:

y = mx + b

3 = 1(5) + b

-2 = b

y = x-2

Answer Link

Otras preguntas

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now

The moon can always be seen from every part of the earth. This is a(n) ____________statement. a. Qualified c. Neither of these b. Absolute d. Both of these

What’s the missing side?

Need help ASAP !!!!!!!

In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?

what is 3/5 of 21? plz answer the question

punctuated equilibrium definition biology

An element's atomic number is 64. How many protons would an atom of this element have?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat