angelicajones4748 angelicajones4748
  • 04-04-2020
  • Physics
contestada

This is the measurement from bottom to top of something. How tall something is.

Respuesta :

olatunbosunadeoke
olatunbosunadeoke olatunbosunadeoke
  • 04-04-2020

Answer: Height

Explanation:

Height is the term that refers to the vertical distance from the bottom to the topmost part of any object. i.e

- a person height tells how tall he/she is,

- a building height tells the distance from ground level to the highest part.

Hence, height is measured in metres.

Answer Link

Otras preguntas

Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
What would be the most likely effect of one company buying a competitor?
a antonym for biosphere
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5