Iwritewithpencils
Iwritewithpencils Iwritewithpencils
  • 14-05-2020
  • Biology
contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105
andyk38105 andyk38105
  • 14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

800 is 10 times as much as_____
5000 is 1/10 of what
What is the lcm of two numbers that have no common factors greater than 1?
900 is 1/10 of what?
is the decimal form of 13/3 a rational number.
what does alignment mean in dance?
The GCF (Greatest Common Factor) of 45 and 75. Show your work too. Thanks for your help!
give me a sentence with the words risk and wages
25% of 88 is the same as what percent of 22? 1) 12 1/2% 2)40% 3) 50% 4) 100%
8 times 51 show your work