sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

Although the most frequent forms of down syndrome are caused by a random error, nondisjunction of chromosome 21, down syndrome occasionally runs in families. th

Choose the best topic sentence for the following passage. Slow music can make you feel sad. Upbeat music can make you feel happy. If you walk while listening

Which of the following is a primary cause of LO/TO accidents? A) The machine was overused B) The machine or piece of equipment was not completely shut off C)

What would happen to aquatic organisms of solid water were denser than liquid water?

Please Help Me with this question!!!!

How do you solve 58ad/b ?

the digit 5 in the number 9645 represents a value that is ____ times as large as the digit 5 in the number 62,594 A

the kind and number of bonds an atom can form depends on what?

In a fully developed paragraph, explain how Georgia's location in the world affects its economy, culture, and development

Carl reads for an average of 1hr25min each night. How many hours does he read in 4 weeks? Enter a mixed number.