Seudónimo Seudónimo
  • 03-12-2020
  • Mathematics
contestada

graph the function in the image

graph the function in the image class=

Respuesta :

Аноним Аноним
  • 03-12-2020

Answer:

The slope is 1.

Step-by-step explanation:

Any time you see x by itself, imagine there is a one behind it.

Answer Link

Otras preguntas

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What do the tympanic membranes do for the frog?
Renaissance painters in flanders as in italy tended to produce work that was
What was OPEC protesting when it imposed it's embargo?
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
can someone help me please
WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t
The culture of children strongly approves of children tattling on one and other. a. True b. False
which item below is part of the circulatory system a. kidneysb. lungsc. heart or d. stomach