Seudónimo Seudónimo
  • 04-01-2021
  • History
contestada

big brain, help me lol

big brain help me lol class=

Respuesta :

samantha12321
samantha12321 samantha12321
  • 05-01-2021

Answer:

put the x axis dot on 7 and the y axis dot on 2

Explanation:

Answer Link

Otras preguntas

Suppose for a particular year a firm had comprehensive income of $9,000, a beginning book value of equity of $76,000, and an ending book value of equity of $77,
Why did Italy fall to totalitarianism?
which statement is true about the graph of the equation y=csc^-1(x)​
y = 2x + 4 2x - y = 6 Solve the system of equations using substitution.
Public policies a. may be able to improve either economic efficiency or equality. b. may be able to improve economic efficiency but cannot improve equality. c.
What transformed American business and industry in the 1980s?
Three divide by one fourth
TB MC Qu. 4-44 Privott, Inc., manufactures ... Privott, Inc., manufactures and sells two products: Product Z9 and Product N0. The company is considering adoptin
Which of the statements are true of both first- and second-division nondisjunction? Select all that apply. Sister chromatids fail to separate. Half of the gamet
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA