madimgodfrey375
madimgodfrey375 madimgodfrey375
  • 01-02-2021
  • Mathematics
contestada

The roots of x2 - 2x - 2 = 0 are

Respuesta :

dar119 dar119
  • 01-02-2021

Answer:

-2X=O

X=0

THE ANSWER IS X=0

Step-by-step explanation:

Hopes it helps

Ver imagen dar119
Ver imagen dar119
Answer Link

Otras preguntas

What is the term for the amount of space occupied by an object? A. mass B. weight C. density D. volume
find mistake I will give brainlist
A box is sliding with a speed of 4.50 m/s on a horizontal surface when, at point P, it encounters a rough section. On the rough section, the coefficient of fric
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
Seven less than the quotient of a number and 12
are brainiest if u get the right answer no internet please or no brainiest. How big is an atom?
13r + 5 + 2n i really really need help
check which of the following is a solution to the equation x-2y=4.​
Two charges repel one another at 5N, if the distance between them is 2m and the force increases to 25N, what is the new distance?
On January 1, you plan to take a trip around the world upon graduation four years from now. Your grandmother wants to deposit sufficient funds for this trip in