dkyouassa
dkyouassa dkyouassa
  • 03-03-2021
  • Chemistry
contestada

lable each change as chemical or physical​

Respuesta :

TheMysticFrost
TheMysticFrost TheMysticFrost
  • 03-03-2021

Answer:

we need the picture

Explanation:

Answer Link

Otras preguntas

In the diagram below, three lines intersect at N. The measure of angle GNF is 60°, and the measure of angle MNL is 47º.Find the measurement of angle HNK
Identify all pairs of congruent corresponding parts.Then write another congruence statement for the polygons.AABC ~ADEF
see image for question
What series of transformations gets from the pre image of rectangle ABCD to the image of rectangle A''B''C''D"
C47. Which coordinate is the solution to the system?A. (-2,-1)B. (1, 2)C. (-2, 1)D. (-1,-2)
For a small plane, v , the angle of depression of a sailboat is 21 degrees. The angle of depression of a ferry on the other side of the plane is 52 degrees. The
Use the graph to respond to the questions. 6a. What is the height of the ball before its thrown? b. Approximately how high in the air did the ball go? C. NWAOOO
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
Two similar cylinders have surface areas of 20π square feet and 90π square feet. What is the ratio of the height of the large cylinder to the height of the smal
Jerome is making beef stew for his family. The recipe calls for 3.5 pounds (lbs.) of stew meat. He notices that he has 1.25 pounds (lbs.) in his refrigerator. H