video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

how did the quantum mechanical model of the atom improve on Borh's atomic model?
In an earthquake-prone area, it has been many years since the last earthquake along a fault. Should residents be concerned about a future earthquake? Explain.
Question 1. How many planes are shown in he figure A. 4 B. 5 C. 6 D. 7 Question 2. Which of the following points are collinear ? A. B, H, D B. A, C, E C. A,
A particular plant root grows 3.5 inches per month. How many centimeters is the plant root growing per month? (1 inch = 2.54 centimeters).
if i have to round my meam to the nearest tenth how do i do that?
Magma can form when
What are some of the characteristics of supercell thunderstorms, compared to other kinds of thunderstorms?
Why eubacteria is called true bacteria
What was a key result of operation desert storm?
How did many northern democrats feel about lincoln's emancipation proclamation?