brookeconner97owgbr5
brookeconner97owgbr5 brookeconner97owgbr5
  • 03-05-2021
  • Mathematics
contestada

The measure of two angles are shown in the
diagram.
4x - 11
2x + 5
Which equation can be used to find the value of x?
A.
6x - 6 = 180
C. 6x + 64 = 180
B. 6x - 6 = 360
D. 6x + 84 = 180

The measure of two angles are shown in the diagram 4x 11 2x 5 Which equation can be used to find the value of x A 6x 6 180 C 6x 64 180 B 6x 6 360 D 6x 84 180 class=

Respuesta :

sahil44
sahil44 sahil44
  • 04-05-2021

Answer:

The measure of two angles are shown in the diagram. 4x - 11 2x + 5 Which equation can be used to find the value of x? A. 6x - 6 = 180 X. 6 x + 64 = 180 B. 6x - 6 = 360 D. 6x + 84 = 180

हिंदी में खोजें

Answer Link

Otras preguntas

a) How did consumers spend their 2008 tax cut (News, p. 237 in your textbook)? b) Does it matter what they spend it on, in terms of impact on Aggregate Demand
Adam wants to compare the fractions three twelths ,one sixth ,one third. He wants to order them from least to greatest and rewrite them so they all have the sam
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
The U.S. Navy has long proposed the construction of extremely low frequency (ELF waves) communications systems; such waves could penetrate the oceans to reach d
The volume of a right circular cone that has a height of 13 m and a base with a diameter of 3.4 m. Round your answer to the nearest tenth of a cubic meter.
What does molarity tell us that percent solution information does not tell us?
Need help with this on number 3 and 4
1. True or False: More civilians died during the war than soldiers. (10 Points) O True O False
what is a word problem for y=3.5x+4
The Chinese porcelain vase we studied had a _ representation of clouds.