MiraculousLadyBug949
MiraculousLadyBug949 MiraculousLadyBug949
  • 02-09-2021
  • Mathematics
contestada

How can powers of ten be used to find the product of 40 x 10^5?

Enter your answers In the boxes as whole numbers

You can add __ zeros to the end of the number 40 to get the product of __.

Respuesta :

MommaBear2012 MommaBear2012
  • 02-09-2021

Answer:

You can add 6 zeros to the end of the number 40 to get the product of 40 x 10^5.

Step-by-step explanation:

Answer Link
shannondean334
shannondean334 shannondean334
  • 11-02-2022

Answer: you can add 6 zeros  to the end of the number 40 to get the product of 40 x 10 ^5

Step-by-step explanation:

Answer Link

Otras preguntas

Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
4.2meters= how many centimeter
How to change 3 7/8 into an improper fraction
in what area of Europe were the majority of warsaw pact countries
Solve the equation -10 + 3x + 5x = -56 ? ??
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front