pakasmojica4
pakasmojica4 pakasmojica4
  • 01-12-2021
  • Mathematics
contestada

What is the slope of this line?

What is the slope of this line class=

Respuesta :

reinhard10158
reinhard10158 reinhard10158
  • 01-12-2021

Step-by-step explanation:

the slope of the line is expressed as the ratio

y coordinate change / x coordinate change

when going from one point to the other.

the trick in such a situation is to find good points on the chart that are crossed by the line. and by "good" I mean points with round integer coordinates.

I see 2 such points :

(-2, 3) and (0, -3)

x changes by +2 (from -2 to 0)

y changes by -6 (from 3 to -3)

the slope is -6/+2 = -6/2 = -3

Answer Link

Otras preguntas

What are the factors of 6x + 24?
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Why was wilson not able to finish his speaking tour
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
in what area of Europe were the majority of warsaw pact countries
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
3+1/4x greater than 11
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5