anachipolLaLacePro anachipolLaLacePro
  • 03-02-2017
  • History
contestada

Why was the launching of sputnik a significant event?

Respuesta :

littleboltax
littleboltax littleboltax
  • 03-02-2017
The launching of Sputnik was significant because it started the Race to space. Once Russia did this, the US formed NASA and sent up their first satellite. 
Answer Link
aldozcalderonp3hlpl aldozcalderonp3hlpl
  • 25-10-2018

The answer is

D.


It prompted a space race between the U.S. and U.S.S.R.


Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A mudflow consists of debris with a large amount of
show work and factor ?
A train leaves new york at 4:00 pm. a second train leaves the same city in the same direction at 6:00 pm. the second train travels 60mph faster than the first.
Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
Attorney general a. mitchell palmer believed that he needed to protect the american people from
the members of an animal community are usually similar in
Explain the carbon cycle and explain why burning fossil fuels is an issue.
help pls :) I am stuck on this chemistry question about percentage yields!