addieGGralticess addieGGralticess
  • 15-02-2017
  • Physics
contestada

Assuming that the density of air is 1.3 g/l, how many grams of carbon monoxide are in 1.0 l of air at the maximum allowable concentration?

Respuesta :

Аноним Аноним
  • 24-02-2017
Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.
35x1.3/1000000 = 0.0000455g = 0.0455 mg = 45.5 microgram/L


Answer Link

Otras preguntas

when Jefferson took office he did what
Please help with Algebra 1
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what are the 2 major types of cofactors?
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
What are some methods used by Mussolini to rise to power?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t