NolieT5364 NolieT5364
  • 03-11-2022
  • Mathematics
contestada

(-2 + 1) + 5(12:3)-9=

Respuesta :

GerrodV148479 GerrodV148479
  • 03-11-2022
[tex]\begin{gathered} (-2+1)^2+5(12\times\frac{1}{3})-9 \\ (-1)^2+5(4)-9 \\ 1+20-9 \\ 21-9 \\ 12 \end{gathered}[/tex]

Answer Link

Otras preguntas

a summary about concussions
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
Help pl0x, Algebra 1
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
how would u form a superlative for the adverb widely