BellissaU76163 BellissaU76163

03-11-2022
Mathematics

contestada

Is the following triangle acute, right, or obtuse?a = 7 ft., b = 11 ft., c = ft.ARightRightBAcuteAcuteCObtuseSkip to navigation

Respuesta :

AadhavanS656582 AadhavanS656582

03-11-2022

Explanation:

The dimensions of the rectangle is given below as

Answer Link

Otras preguntas

Exponential Equation WITHOUT CALCULATOR

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What nursing actions best promote communication when obtaining a nursing history? select all that apply?

NEED HELP WORTH 50 POINTS !! Holly has a rectangular garden that measures 12 m wide by 14 m long. She wants to increase the area to 255 m2 by increasing the wi

If two populations are isolated, they may become separate species because they are not longer ________.

If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

Can someone please help me with numbers 1, a, b, c, 2, a, b, c