TarrenG355580 TarrenG355580
  • 03-11-2022
  • Mathematics
contestada

W XZWhich statement regarding the diagram is true?O mzWXY = mzYXZO mzWXY

W XZWhich statement regarding the diagram is trueO mzWXY mzYXZO mzWXY class=

Respuesta :

NalinV743514 NalinV743514
  • 03-11-2022

Linear pair of angles are formed when two lines intersect each other at a single point.

The angles are said to be linear if they are adjacent to each other after the intersection of the two lines.

The figure shows the line WZ intersected by lines YX and YZ. At X, two adjacent angles are formed at the point where WZ and YX intersect.

This means angles WXY and YXZ are linear angles.

Linear angles always add up to 180°, thus:

m∠WXY + m∠YXZ = 180°

Ver imagen NalinV743514
Answer Link

Otras preguntas

What are the factors of 6x + 24?
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
How many times does four go into 153 ? What Is the remainder ?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
what is the lcd of 10/11,29/44
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What kind of problems did increased urbanization cause? During time of industrial revolution
What Role Does the Sun Play in Producing Winds And Ocean Currents
How much money, in dollars, does one mole of nickels represent?