cindavesam
cindavesam cindavesam
  • 03-04-2017
  • Social Studies
contestada

from this passage you can incur that poor people lived

Respuesta :

ricky412
ricky412 ricky412
  • 03-04-2017
where is the passage

Answer Link
ILikeGoats
ILikeGoats ILikeGoats
  • 29-04-2020

Answer:A

Hopefully I Helped You And This Was Right :D

Explanation:

A. Did Not Live In Handsomes Homes.

B. Lived Intermixed With The Rich People.

C. Escaped The Heat And Dust Of Rome.

D. Had Aviaries.

Answer Link

Otras preguntas

The opposite of the word sombre
You have passed all your tests. You ____ be very pleased with yourself.mustn'tshouldmustshouldn't​
CaCl2 + Na2CO3 → CaCO3 + 2 NaCl 1. How many moles of calcium carbonate (CaCO3) are produced when 8.45 moles of calcium chloride react (CaCl2)? *
Rolling a single die, what is the probability of rolling a number less than 4?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
A batch of cookies equals a dozen. I want to split 2 and 3/4 batches of cookies among 4 people. How many whole cookies will each person get *
what if acidic chyme is not neutralized in the small intestine?
-8 (4 - 4a) -2 = 222
What organism is penicillin derived from ?
I don’t know how to do it and I need help