taylorwatkins taylorwatkins
  • 03-11-2017
  • History
contestada

Which was the result of Vietnam’s civil war in 1975

Respuesta :

xpertthief592
xpertthief592 xpertthief592
  • 03-11-2017
It was a direct result of the First Indochina War (1946–1954) between France, which claimed Vietnam as a colony, and the communist forces then known as Viet Minh. In 1973 a “third” Vietnam war began—a continuation, actually—between North and SouthVietnam but without significant U.S. involvement.
Answer Link

Otras preguntas

What contributed to social stratification that developed in the united states in the late 19th century?
what does a light year measure
Solve for x. Assume that lines which appear tangent are tangent.
the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
Identify the consequences—both long-term and short-term—of the vietnam war.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How did censorship and propaganda help fortify post ww1 dictatorships?
i will mark as brainiest you answer this easy question
Why did North Carolina and South Carolina split into two colonies? A. They had different beliefs about slavery. B. They had large groups of competin
A mudflow consists of debris with a large amount of