destinytofell6197 destinytofell6197
  • 02-03-2018
  • Social Studies
contestada

The most important aspect of a hypothesis is that it must be a ___________ idea.

Respuesta :

BriM19
BriM19 BriM19
  • 11-03-2018
The correct answer is a testable idea.

A Hypothesis is a assumed explanation for a certain event or phenomenon. For a hypothesis to be accepted for scientific research, first and foremost, the hypothesis should be able to undergo research or testing. It must hold the element of being testable for it to be proven.
Answer Link

Otras preguntas

4(3-5)=-2(8-z)-6z what is z
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
where are the three parts of an atom located
Why were the committees of correspondence powerful?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Fossils are most commonly found in which type of rock?
How well did feudalism establish order in the Middle ages?