faithlashea31 faithlashea31
  • 04-04-2018
  • English
contestada

Select the two main components of effective conversation

Respuesta :

clarissahaney94
clarissahaney94 clarissahaney94
  • 16-04-2018
Listening and speaking.
Answer Link
26229
26229 26229
  • 14-09-2018

the answer is Listening and speaking.


Answer Link

Otras preguntas

Photosynthesis uses carbon dioxide, while cellular respiration produces carbon dioxide?
What do you think happens to a fish’s behavior in cold climates during the winter? Explain your answer.
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
PLEASE HELP I NEED ANSWER ASAP5. EXPOSITORY WRITING Suppose that you are on a committee to write a new state constitution. Identify three freedoms you want the
Why did Bilbo join the adventure
Notice that the original recipe calls for 1/4 cup of water. If you put in 3/8 cup of water, by how much have you multiplied the original recipe? How many people
What Nobel prize was trump nominated for
HELP PLEASE ASAP THANK YOU VERY MUCH
Prior do the 1600s it was believed that all living things for either plants or animals. Which of these inventions led to the development of a more detailed clas
Which of the following statements is true? A. A golf ball has a larger volume than a baseball. B. Most of the substances found on Earth are compounds. C. Water